Part 2

Spot the Difference

In each of the following scenarios, think:

• What output was intended?
• Why doesn't the written expression produce the intended output?

• What could you change to fix the expression?

• I have 100 sweets in a bowl. I give 10 to James, 13 to Vela, 11 to Malai and 14 to Alex. 31 fall on the floor and the bowl breaks. How many do I have left?

  100 – 10 – 13 – 11 – 14 - 31
  

• Find \(3+\sqrt[3]{27}\)

  3 + ÷3*27
  

• Find the distance between the points (3,12) and (6,16) in Euclidean space

  ((16-12)*2 + (6-3)*2)*0.5
  

• List the numbers from 13 to 27 inclusive

  ⍳ 27 - 13
  

• Return 1 when X>3 and X≤7

  X ← 10
  X > 3 ∧ X ≤ 7
  

• Sum the salaries of employees in group G

  Grp ← 'AFGFG'
  Sal ← 32000 33500 41000 33900 41500
  +/ Grp='G' / Sal
  

Vectors and Matrices

1. Define the numeric vector nums

   nums ← 3 5 8 2 1
   

   1. Using nums, define mat

         mat
   

   3 5 8
   2 1 3
   

   1. Using mat, define wide

         wide
   

   3 5 8 3 5 8
   2 1 3 2 1 3
   

   1. Using mat, define stack

         stack
   

   3 5 8
   3 5 8
   2 1 3
   2 1 3
   

2. Why does 101='101' evaluate to a 3-element list?

Slashes

By hand, evaluate the following expressions:

1. +/3 1 4
2. 3/3 1 4
3. 2 6++/5 2
4. 2 6+3/5
5. 2 6+2/5

Indexing

1. Write a function PassFail which takes an array of scores and returns an array of the same shape in which F corresponds to a score less than 40 and P corresponds to a score of 40 or more.

         PassFail 35 40 45
   FPP
   
         PassFail 2 5⍴89 77 15 49 72 54 25 18 57 53
   
   PPFPP
   PFFPP
   

Analysing Text

1. Analysing text

   1. Write a function test if there are any vowels 'aeiou' in text vector ⍵

            AnyVowels 'this text is made of characters'
      1
            AnyVowels 'bgxkz'
      0
      

   2. Write a function to count the number of vowels in its character vector argument ⍵

            CountVowels 'this text is made of characters'
      9
      
            CountVowels 'we have twelve vowels in this sentence'
      12
      

   3. Write a function to remove the vowels from its argument

            RemoveVowels 'this text is made of characters'
      ths txt s md f chrctrs
      

APL Quest Problems

1: Grille

A Grille is a square sheet with holes cut out of it which, when laid on top of a similarly-sized character matrix, reveals a hidden message. Write an APL function Grille which: - takes a character matrix left argument where a hash '#' represents opaque material and a space ' ' represents a hole. - takes a character matrix of the same shape as right argument - returns the hidden message as a character vector

      (2 2⍴'# # ') Grille 2 2⍴'LHOI'
HI
      grid   ← 5 5⍴'VRYIALCLQIFKNEVPLARKMPLFF'
      grille ← 5 5⍴'⌺⌺⌺ ⌺ ⌺⌺⌺ ⌺ ⌺ ⌺⌺⌺ ⌺⌺⌺  ⌺⌺'
      grid grille
┌─────┬─────┐
│VRYIA│⌺⌺⌺ ⌺│
│LCLQI│ ⌺⌺⌺ │
│FKNEV│⌺ ⌺ ⌺│
│PLARK│⌺⌺ ⌺⌺│
│MPLFF│⌺  ⌺⌺│
└─────┴─────┘
      grille Grille grid
ILIKEAPL

2: Attack of the Mutations!

This problem is inspired by the Counting Point Mutations problem found on the excellent Bioinformatics education website rosalind.info.

Write a function that:

• takes right and left arguments that are character vectors or scalars of equal length – these represent DNA strings.
• returns an integer representing the Hamming distance (the number of differences in corresponding positions) between the arguments.

Hint: The plus function X+Y could be helpful.

Examples

      'GAGCCTACTAACGGGAT' (your_function) 'CATCGTAATGACGGCCT' 
7

      'A' (your_function) 'T'
1

      '' (your_function) ''
0

      (your_function)⍨ 'CATCGTAATGACGGCCT'
0

3: Counting DNA Nucleotides?

This problem was inspired by Counting DNA Nucleotides found on the excellent bioinformatics website rosalind.info.

Write a function that:

• takes a right argument that is a character vector or scalar representing a DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T').
• returns a 4-element numeric vector containing the counts of each symbol 'A', 'C', 'G', and 'T' respectively.

Examples

      
      (your_function) 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
20 12 17 21

      (your_function) ''
0 0 0 0

      (your_function) 'G'
0 0 1 0

4: Making the Grade

Score Range	0-64	65-69	70-79	80-89	90-100
Letter Grade	F	D	C	B	A

Write a function that, given an array of integer test scores in the inclusive range 0 to 100, returns a list of letter grades according to the table above.

      Grade 0 10 75 78 85

FFCCB